Публикации
Спиридонов C.Э., O.В. Бойко.
Молекулярная идентификация бактерий рода Wolbachia от нематод Dirofilaria immitis, паразитирующих в сердце собак в Астраханской области
// Нематоды естественных и трансформированных экосистем. Сборник научных статей. Петрозаводск: КарНЦ РАН, 2011. C. 96-98
Wolbachia are quite common intracellular symbiotic bacteria of arthropods, but also reported from a list on nematode species, mainly representatives of the superfamily Filarioidea. These bacteria are important biotic factor, which is crucial for the completion of life cycle in Wolbachia-bearing filariids, including dog-parasitic Dirofilaria immitis. The presence of Wolbachia in the Dirofilaria immitis nematodes from dogs of Astrakhan region was detected with PCR. The homogenates of single worm (male and female of D. immitis) were used as template for PCR. Several pairs of primers were used to amplify and partially sequence the following domains of bacterial DNA: GroEL, ftsZ and wsp. The size of obtained PCR products was about 900 bp size with primers groELf (GGTGAGCAGTTRCARSAAGC) and groELr (AGRTCTTCCATYTTRATTCC), 730 bp size with primers WSP81F (TGGTCCAATAAGTGATGAAGAAAC) and WSP691R (AAAAATTAAAC GCTACTCCA), 550 bp size with primers ftsZ F (CTTGGTGCTGGT GCTTTGCCT) and ftsZ R (TACCAATCA TTGCTTTACCCA) and 800 bp size with primers ftsZUNIF (GGYAARGGTGCRGCAGAAGA) and ftsZUNIR (ATCRATRCCAGTTGCAAG). Primers WSPFILF (CGCTTGCAGTACAA TAGT GAG) and WSPFIL R (GCTTCTGCACCAATAGTGCT) were not working with homogenates of D. immitis from Astrakhan region. Obtained sequences were studied using BLAST option of NCBI GenBank. All the obtained sequences demonstrated nearly complete identity with similarsequences of Wolbachia pipientis fro the nematode D. immitis.

Молекулярная идентификация бактерий рода Wolbachia от нематод Dirofilaria immitis, паразитирующих в сердце собак в Астраханской области (307 Kb, скачиваний: 354)

Последние изменения: 24 мая 2012